Transcript: Human XR_001738883.1

PREDICTED: Homo sapiens sodium voltage-gated channel alpha subunit 1 (SCN1A), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCN1A (6323)
Length:
8565
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738883.1
NBCI Gene record:
SCN1A (6323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044309 GCGGCTATTGAAAGACGCATT pLKO.1 453 3UTR 100% 4.050 5.670 N SCN1A n/a
2 TRCN0000044310 CGGAAGACTTTAGTAGTGAAT pLKO.1 3772 3UTR 100% 4.950 3.960 N SCN1A n/a
3 TRCN0000435019 CTCATCTCTCTACGCCATTAT pLKO_005 5224 3UTR 100% 13.200 9.240 N SCN1A n/a
4 TRCN0000044311 GCCAATGTCCAGAGGGATATA pLKO.1 1414 3UTR 100% 13.200 9.240 N SCN1A n/a
5 TRCN0000426393 TGCTAATTATGTGCACTATTT pLKO_005 781 3UTR 100% 13.200 9.240 N SCN1A n/a
6 TRCN0000417278 TTATCTGTTCTCCGTTCATTT pLKO_005 2949 3UTR 100% 13.200 9.240 N SCN1A n/a
7 TRCN0000044312 GCTGTGGATAGGATGCACAAA pLKO.1 3429 3UTR 100% 4.950 3.465 N SCN1A n/a
8 TRCN0000173658 CTTTGCTTCAAGTTGCCACAT pLKO.1 4721 3UTR 100% 4.050 2.835 N Scn1a n/a
9 TRCN0000225832 TCAGCATCATGGGCGTAAATT pLKO_005 4532 3UTR 100% 15.000 9.000 N Scn1a n/a
10 TRCN0000044308 CGCATCAATCTGGTGTTCATT pLKO.1 5173 3UTR 100% 5.625 3.375 N SCN1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.