Transcript: Human XR_001738903.2

PREDICTED: Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPS9 (64965)
Length:
2523
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738903.2
NBCI Gene record:
MRPS9 (64965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435547 ACTGTCAGATCTAGATTATAT pLKO_005 1769 3UTR 100% 15.000 10.500 N MRPS9 n/a
2 TRCN0000117476 GAAGAAGTGTAACTCTTGAAT pLKO.1 1867 3UTR 100% 5.625 3.938 N MRPS9 n/a
3 TRCN0000117473 CCAGAAACTTTCACTCAAGAA pLKO.1 910 3UTR 100% 4.950 3.465 N MRPS9 n/a
4 TRCN0000117474 CCGTCCATTTCACTATCTCTT pLKO.1 1056 3UTR 100% 4.950 3.465 N MRPS9 n/a
5 TRCN0000104469 CTGATTAAGGAGGAACTAGAA pLKO.1 1731 3UTR 100% 4.950 3.465 N Mrps9 n/a
6 TRCN0000117475 GCTGGACTACTTACTACTGAT pLKO.1 2232 3UTR 100% 4.950 3.465 N MRPS9 n/a
7 TRCN0000117472 GCTATATATATGTGCCGACAT pLKO.1 2354 3UTR 100% 4.050 2.835 N MRPS9 n/a
8 TRCN0000420032 ACATAGGAAAGAGACATTTAG pLKO_005 869 3UTR 100% 13.200 7.920 N MRPS9 n/a
9 TRCN0000418587 AGGCTAAGACATACTGCATTT pLKO_005 766 3UTR 100% 10.800 6.480 N MRPS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03991 pDONR223 100% 47% None 1_624del;1197_1705del;2322_2523del n/a
Download CSV