Transcript: Human XR_001740010.2

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily H member 8 (KCNH8), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNH8 (131096)
Length:
4160
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740010.2
NBCI Gene record:
KCNH8 (131096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016886 CCTCTATCACACTAGAACTAA pLKO.1 1621 3UTR 100% 5.625 3.938 N KCNH8 n/a
2 TRCN0000175423 CGGAACACATAGCAACTTCAT pLKO.1 247 3UTR 100% 4.950 3.465 N Kcnh8 n/a
3 TRCN0000016885 GCAGCAGATAAACAAACTCAA pLKO.1 2739 3UTR 100% 4.950 3.465 N KCNH8 n/a
4 TRCN0000016887 CCCATAGTCTACTGTTCCGAT pLKO.1 299 3UTR 100% 2.640 1.848 N KCNH8 n/a
5 TRCN0000016883 GCAGTGAAGAAAGTCAGACTT pLKO.1 2612 3UTR 100% 4.950 2.970 N KCNH8 n/a
6 TRCN0000016884 CCGAACAACTTATGTCAGCAA pLKO.1 1006 3UTR 100% 2.640 1.584 N KCNH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.