Transcript: Human XR_001740240.1

PREDICTED: Homo sapiens synapsin II (SYN2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYN2 (6854)
Length:
4079
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740240.1
NBCI Gene record:
SYN2 (6854)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416403 CAACTCACTGGAATCCATATA pLKO_005 825 3UTR 100% 13.200 18.480 N SYN2 n/a
2 TRCN0000416571 GTGCTTGTAATGCTCACTTAT pLKO_005 1974 3UTR 100% 13.200 9.240 N SYN2 n/a
3 TRCN0000424353 CCATGTCAGACAGGTACAAAC pLKO_005 1397 3UTR 100% 10.800 7.560 N SYN2 n/a
4 TRCN0000147125 CAACAACTACAAGGCTTACAT pLKO.1 1314 3UTR 100% 5.625 3.938 N SYN2 n/a
5 TRCN0000148561 CCCTCTCATTGAACAGACATA pLKO.1 918 3UTR 100% 4.950 3.465 N SYN2 n/a
6 TRCN0000149623 GCCTTTCATTGACTCCAAGTA pLKO.1 1269 3UTR 100% 4.950 3.465 N SYN2 n/a
7 TRCN0000147944 GCTTTCTTTCTGCATGACTAT pLKO.1 2281 3UTR 100% 4.950 3.465 N SYN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.