Transcript: Human XR_001740327.2

PREDICTED: Homo sapiens HPS3 biogenesis of lysosomal organelles complex 2 subunit 1 (HPS3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPS3 (84343)
Length:
3535
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740327.2
NBCI Gene record:
HPS3 (84343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232932 CATGGGTTCACGTCGTAATAT pLKO_005 2616 3UTR 100% 15.000 21.000 N HPS3 n/a
2 TRCN0000232930 ATCCGAATGATTGGGCATAAT pLKO_005 416 3UTR 100% 13.200 18.480 N HPS3 n/a
3 TRCN0000082956 GCACGTCATTACAAGTAACAA pLKO.1 1249 3UTR 100% 5.625 7.875 N HPS3 n/a
4 TRCN0000232929 CAGCGAGGCTGGAGATTATTT pLKO_005 307 3UTR 100% 15.000 10.500 N HPS3 n/a
5 TRCN0000082957 CTGTAGTCATTATGGCTTAAT pLKO.1 2590 3UTR 100% 13.200 9.240 N HPS3 n/a
6 TRCN0000082954 GCTCCTGATATTTCGTCCTAT pLKO.1 992 3UTR 100% 4.950 3.465 N HPS3 n/a
7 TRCN0000082955 GCCTGTAGTCATTATGGCTTA pLKO.1 2588 3UTR 100% 4.050 2.835 N HPS3 n/a
8 TRCN0000232931 ATAAGACCAACAATCGAATAA pLKO_005 777 3UTR 100% 13.200 7.920 N HPS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09184 pDONR223 100% 83.5% None (many diffs) n/a
2 ccsbBroad304_09184 pLX_304 0% 83.5% V5 (many diffs) n/a
Download CSV