Transcript: Human XR_001740351.1

PREDICTED: Homo sapiens lysine acetyltransferase 2B (KAT2B), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KAT2B (8850)
Length:
4319
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740351.1
NBCI Gene record:
KAT2B (8850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018532 GTTGGCTATATCAAGGATTAT pLKO.1 1844 3UTR 100% 13.200 18.480 N KAT2B n/a
2 TRCN0000364136 TTAATGGGATGTGAGCTAAAT pLKO_005 1877 3UTR 100% 13.200 18.480 N KAT2B n/a
3 TRCN0000364134 CCTAAACCGCATCAACTATTG pLKO_005 824 3UTR 100% 10.800 15.120 N KAT2B n/a
4 TRCN0000018530 CGAACTCTAATCCTCACTCAT pLKO.1 1086 3UTR 100% 4.950 6.930 N KAT2B n/a
5 TRCN0000018531 GCTGGGACAATTTCATACAAT pLKO.1 1242 3UTR 100% 5.625 4.500 N KAT2B n/a
6 TRCN0000018529 GCAGATACCAAACAAGTTTAT pLKO.1 612 3UTR 100% 13.200 9.240 N KAT2B n/a
7 TRCN0000364135 TGGCATGTCCATTAGCTATTT pLKO_005 2690 3UTR 100% 13.200 9.240 N KAT2B n/a
8 TRCN0000018528 GCAGACTTACAGCGAGTCTTT pLKO.1 2312 3UTR 100% 0.495 0.347 N KAT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.