Transcript: Human XR_001741152.2

PREDICTED: Homo sapiens DEAH-box helicase 15 (DHX15), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX15 (1665)
Length:
2990
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741152.2
NBCI Gene record:
DHX15 (1665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420388 GTGGAGTACATGCGATCATTA pLKO_005 684 3UTR 100% 13.200 18.480 N DHX15 n/a
2 TRCN0000000006 GTTGGTTCGATAATGGCCTTT pLKO.1 2623 3UTR 100% 4.050 5.670 N DHX15 n/a
3 TRCN0000000009 TGTAAGAGAATAAAGCGTGAA pLKO.1 1257 3UTR 100% 4.050 5.670 N DHX15 n/a
4 TRCN0000425479 TTGGTGACAGCTATTAGTAAA pLKO_005 1530 3UTR 100% 13.200 9.240 N DHX15 n/a
5 TRCN0000307435 TGTTGACACTGTAGCTCATAC pLKO_005 2724 3UTR 100% 10.800 7.560 N Dhx15 n/a
6 TRCN0000000007 ACTGTTCTAATGAGGTCCTAT pLKO.1 1906 3UTR 100% 4.950 3.465 N DHX15 n/a
7 TRCN0000000008 TGGGAATACAAGGATAGGTTT pLKO.1 579 3UTR 100% 4.950 3.465 N DHX15 n/a
8 TRCN0000000010 GCTTCAACAAATGCTATGCTT pLKO.1 348 3UTR 100% 3.000 2.100 N DHX15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.