Transcript: Human XR_001742214.1

PREDICTED: Homo sapiens solute carrier family 12 member 2 (SLC12A2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC12A2 (6558)
Length:
6909
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742214.1
NBCI Gene record:
SLC12A2 (6558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308234 TACCGGCAGATCAGGTTAAAT pLKO_005 3663 3UTR 100% 0.000 0.000 N SLC12A2 n/a
2 TRCN0000042947 GCACCAAGGATGTGGTAGTAA pLKO.1 2995 3UTR 100% 5.625 4.500 N SLC12A2 n/a
3 TRCN0000296498 ACCAAATTTCATCCATATATC pLKO_005 4209 3UTR 100% 13.200 9.240 N SLC12A2 n/a
4 TRCN0000042946 GCCACTCTTTCTTCAGCATTA pLKO.1 1986 3UTR 100% 10.800 7.560 N SLC12A2 n/a
5 TRCN0000289986 GCCACTCTTTCTTCAGCATTA pLKO_005 1986 3UTR 100% 10.800 7.560 N SLC12A2 n/a
6 TRCN0000042944 GCTCTCTACATGGCATGGTTA pLKO.1 3765 3UTR 100% 4.950 3.465 N SLC12A2 n/a
7 TRCN0000290050 GCTCTCTACATGGCATGGTTA pLKO_005 3765 3UTR 100% 4.950 3.465 N SLC12A2 n/a
8 TRCN0000042945 GCCAAATATCAGCGATGGCTT pLKO.1 2676 3UTR 100% 2.640 1.848 N SLC12A2 n/a
9 TRCN0000042943 CCCTCAAATCTGAGGGACTTT pLKO.1 4710 3UTR 100% 0.495 0.347 N SLC12A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.