Transcript: Human XR_001743533.2

PREDICTED: Homo sapiens magnesium transporter MRS2 (MRS2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRS2 (57380)
Length:
1987
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743533.2
NBCI Gene record:
MRS2 (57380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218653 CAACTCGTTACATACCCTTTA pLKO_005 637 3UTR 100% 10.800 15.120 N MRS2 n/a
2 TRCN0000122067 CTTTGTCAGTATAGGGAATTA pLKO.1 1906 3UTR 100% 13.200 9.240 N MRS2 n/a
3 TRCN0000230268 AGGTGAAGTGCACCGGTTTAG pLKO_005 300 3UTR 100% 10.800 7.560 N MRS2 n/a
4 TRCN0000144470 CCCAGTATTTACTGTGACAAA pLKO.1 360 3UTR 100% 4.950 3.465 N MRS2 n/a
5 TRCN0000141564 CCTTGAGACCTTGGATGCTTT pLKO.1 744 3UTR 100% 4.950 3.465 N MRS2 n/a
6 TRCN0000142311 GATCAGGAAGGAGCATCCTAA pLKO.1 1502 3UTR 100% 4.950 3.465 N MRS2 n/a
7 TRCN0000230270 CTTTCGCTCTTTGGACTAATG pLKO_005 1246 3UTR 100% 10.800 6.480 N MRS2 n/a
8 TRCN0000121808 GATAGAAGCATGGAATTGAAA pLKO.1 1456 3UTR 100% 5.625 3.375 N MRS2 n/a
9 TRCN0000143733 GATGAGGAAGAGTTGCTAGAA pLKO.1 889 3UTR 100% 4.950 2.970 N MRS2 n/a
10 TRCN0000143580 GAGCATCCTAACAAACCGTTA pLKO.1 1512 3UTR 100% 4.050 2.430 N MRS2 n/a
11 TRCN0000230269 ATCATGAGAATGGAGTATTTG pLKO_005 511 3UTR 100% 13.200 6.600 Y MRS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.