Transcript: Human XR_001743771.1

PREDICTED: Homo sapiens BCL2 associated transcription factor 1 (BCLAF1), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCLAF1 (9774)
Length:
6152
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743771.1
NBCI Gene record:
BCLAF1 (9774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220216 CGTAGTAGAGATCGTATGTAT pLKO.1 322 3UTR 100% 5.625 7.875 N BCLAF1 n/a
2 TRCN0000220214 GCGGTTCACTTCGTATCAGAA pLKO.1 2300 3UTR 100% 4.950 6.930 N BCLAF1 n/a
3 TRCN0000336784 GCGGTTCACTTCGTATCAGAA pLKO_005 2300 3UTR 100% 4.950 6.930 N BCLAF1 n/a
4 TRCN0000220217 GCCGGTCATATAGATCTTCTA pLKO.1 572 3UTR 100% 4.950 3.960 N BCLAF1 n/a
5 TRCN0000336703 GCCGGTCATATAGATCTTCTA pLKO_005 572 3UTR 100% 4.950 3.960 N BCLAF1 n/a
6 TRCN0000336707 ACTGTTTGCAAGTAGTCTATA pLKO_005 3439 3UTR 100% 13.200 9.240 N BCLAF1 n/a
7 TRCN0000220215 CCTTCTCAGAATAGTCCAATT pLKO.1 1039 3UTR 100% 10.800 7.560 N BCLAF1 n/a
8 TRCN0000336704 CCTTCTCAGAATAGTCCAATT pLKO_005 1039 3UTR 100% 10.800 7.560 N BCLAF1 n/a
9 TRCN0000220218 CCTGAGCAGGTAAAGTCTGAA pLKO.1 1672 3UTR 100% 4.950 3.465 N BCLAF1 n/a
10 TRCN0000336783 CCTGAGCAGGTAAAGTCTGAA pLKO_005 1672 3UTR 100% 4.950 3.465 N BCLAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.