Transcript: Human XR_001744809.2

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 4 (ABCB4), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB4 (5244)
Length:
4353
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744809.2
NBCI Gene record:
ABCB4 (5244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059709 GCTGGAAATCTCGCCTATTTA pLKO.1 2741 3UTR 100% 15.000 21.000 N ABCB4 n/a
2 TRCN0000059711 GCAAAGATACTCTCGGCATTT pLKO.1 1474 3UTR 100% 10.800 8.640 N ABCB4 n/a
3 TRCN0000424870 GTTCTTGTTGCTGCCTATATA pLKO_005 1150 3UTR 100% 15.000 10.500 N ABCB4 n/a
4 TRCN0000425486 CTAACCTTGGAACTGGTATTA pLKO_005 3290 3UTR 100% 13.200 9.240 N ABCB4 n/a
5 TRCN0000059712 CCCTCATCAGACAACCTCAAA pLKO.1 4092 3UTR 100% 4.950 3.465 N ABCB4 n/a
6 TRCN0000059710 CGACAGGAAATAGGATGGTTT pLKO.1 1246 3UTR 100% 4.950 3.465 N ABCB4 n/a
7 TRCN0000059708 GCCCACTTATTCATGCTGTTT pLKO.1 3542 3UTR 100% 4.950 3.465 N ABCB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.