Transcript: Human XR_001745568.1

PREDICTED: Homo sapiens zinc finger and AT-hook domain containing (ZFAT), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFAT (57623)
Length:
5340
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001745568.1
NBCI Gene record:
ZFAT (57623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001745568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148980 GCCACGTAATTCAGAAACACA pLKO.1 2341 3UTR 100% 3.000 4.200 N ZFAT n/a
2 TRCN0000131174 GCCATTCAGCAGACACCTTAT pLKO.1 723 3UTR 100% 10.800 8.640 N ZFAT n/a
3 TRCN0000150021 CAACAAGGTCTTCAAGTTCAA pLKO.1 809 3UTR 100% 4.950 3.465 N ZFAT n/a
4 TRCN0000147064 CACTTGTGAATACTGCAACAA pLKO.1 794 3UTR 100% 4.950 3.465 N ZFAT n/a
5 TRCN0000148788 CATCTGCATTATCGTGCTGAA pLKO.1 383 3UTR 100% 4.050 2.835 N ZFAT n/a
6 TRCN0000129521 GCACAAGAAGATCAAGCAGCA pLKO.1 1025 3UTR 100% 2.160 1.512 N ZFAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001745568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.