Transcript: Human XR_001746367.1

PREDICTED: Homo sapiens WNK lysine deficient protein kinase 2 (WNK2), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WNK2 (65268)
Length:
10183
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746367.1
NBCI Gene record:
WNK2 (65268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002252 CCAAGATTCAGCGCCCTATAA pLKO.1 4261 3UTR 100% 13.200 18.480 N WNK2 n/a
2 TRCN0000002255 CCGATGAAATTGCCACGTATA pLKO.1 3906 3UTR 100% 10.800 15.120 N WNK2 n/a
3 TRCN0000199250 CGGTTCCTTCAAGACGGTCTA pLKO.1 841 3UTR 100% 4.050 5.670 N WNK2 n/a
4 TRCN0000197192 GCTTACCATCTTGAACGTGTG pLKO.1 3796 3UTR 100% 2.250 3.150 N WNK2 n/a
5 TRCN0000194773 CCTATAAGTCTAGTAGCAAAC pLKO.1 6384 3UTR 100% 6.000 4.800 N WNK2 n/a
6 TRCN0000002254 CGAGACCTGAAATGTGACAAT pLKO.1 1196 3UTR 100% 4.950 3.960 N WNK2 n/a
7 TRCN0000194923 CCTGAAATCAAGGAGATTATT pLKO.1 1502 3UTR 100% 15.000 10.500 N WNK2 n/a
8 TRCN0000002253 GAGGAAAGGTACGAGATCAAA pLKO.1 1547 3UTR 100% 5.625 3.938 N WNK2 n/a
9 TRCN0000195306 CCCAAGAGATGATTGAGTCTG pLKO.1 1764 3UTR 100% 4.050 2.835 N WNK2 n/a
10 TRCN0000002256 GACGCTGAAGACATACCTGAA pLKO.1 1075 3UTR 100% 4.050 2.835 N WNK2 n/a
11 TRCN0000199734 GCCGTCTAAGTGGAGAAGTGA pLKO.1 6994 3UTR 100% 3.000 2.100 N WNK2 n/a
12 TRCN0000199742 GCCAAGACTGTGGGCCGTTTC pLKO.1 5456 3UTR 100% 0.000 0.000 N WNK2 n/a
13 TRCN0000360826 ACAATGGAGCCATAGAGTTTA pLKO_005 1707 3UTR 100% 13.200 9.240 N Wnk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.