Transcript: Human XR_001746396.1

PREDICTED: Homo sapiens mitoguardin 2 (MIGA2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIGA2 (84895)
Length:
1924
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746396.1
NBCI Gene record:
MIGA2 (84895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425571 TGTTCCTGTACACGACGTTTG pLKO_005 297 3UTR 100% 6.000 8.400 N MIGA2 n/a
2 TRCN0000437106 AGATGGTGACAGGCCTGATGA pLKO_005 1433 3UTR 100% 4.950 3.465 N MIGA2 n/a
3 TRCN0000429724 CAATGCAGAGAGCCTGTACAT pLKO_005 739 3UTR 100% 4.950 3.465 N MIGA2 n/a
4 TRCN0000168151 CCCTTCAGTGAAGAAAGGATA pLKO.1 517 3UTR 100% 4.950 3.465 N MIGA2 n/a
5 TRCN0000439781 CATTCTCCCAGCTACGGTTGA pLKO_005 327 3UTR 100% 4.050 2.835 N MIGA2 n/a
6 TRCN0000423139 CTGACTTCAGAGGATTCCTTC pLKO_005 1085 3UTR 100% 4.050 2.835 N MIGA2 n/a
7 TRCN0000167974 CAGTGAAGAAAGGATACTCCA pLKO.1 522 3UTR 100% 2.640 1.848 N MIGA2 n/a
8 TRCN0000168574 GAAGACAAGAGTAACCAGCTT pLKO.1 1390 3UTR 100% 2.640 1.848 N MIGA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.