Transcript: Human XR_001747199.1

PREDICTED: Homo sapiens armadillo like helical domain containing 3 (ARMH3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMH3 (79591)
Length:
2028
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747199.1
NBCI Gene record:
ARMH3 (79591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216882 GAGTACAACAGGCAGTATAAA pLKO.1 860 3UTR 100% 15.000 21.000 N 9130011E15Rik n/a
2 TRCN0000418864 GAGTACAACAGGCAGTATAAA pLKO_005 860 3UTR 100% 15.000 21.000 N ARMH3 n/a
3 TRCN0000414812 GTAATGATCAACAGCATATTT pLKO_005 647 3UTR 100% 15.000 12.000 N ARMH3 n/a
4 TRCN0000197412 CCTTATGATTGTGAACCTATT pLKO.1 1672 3UTR 100% 10.800 7.560 N 9130011E15Rik n/a
5 TRCN0000131024 CTGGACCTGATGGTAGAGTTT pLKO.1 1442 3UTR 100% 4.950 3.465 N ARMH3 n/a
6 TRCN0000178406 GCTGAAGTTCCTTATGTCAAA pLKO.1 1609 3UTR 100% 4.950 3.465 N 9130011E15Rik n/a
7 TRCN0000129715 CCTTATGTCAAATGAGACTGT pLKO.1 1618 3UTR 100% 2.640 1.848 N ARMH3 n/a
8 TRCN0000130901 GCTGTGAATCACATATCCCAA pLKO.1 2005 3UTR 100% 2.640 1.848 N ARMH3 n/a
9 TRCN0000130977 CCAGAGCTTTGACAACCTCTA pLKO.1 1777 3UTR 100% 4.050 2.430 N ARMH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.