Transcript: Human XR_001747255.2

PREDICTED: Homo sapiens LIM domain binding 1 (LDB1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDB1 (8861)
Length:
1467
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747255.2
NBCI Gene record:
LDB1 (8861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233349 TGACGACATGATGCGGATAAA pLKO_005 520 3UTR 100% 13.200 18.480 N Ldb1 n/a
2 TRCN0000021784 CGGAGCTGTACTATGTTCTTA pLKO.1 366 3UTR 100% 5.625 7.875 N LDB1 n/a
3 TRCN0000021788 GCGGATAAAGACGTGGCACTT pLKO.1 532 3UTR 100% 4.050 5.670 N LDB1 n/a
4 TRCN0000021786 GCTGTCCAATTCCACTCTCAA pLKO.1 658 3UTR 100% 4.950 3.960 N LDB1 n/a
5 TRCN0000275510 GGATGGACCAAAGAGATATAC pLKO_005 289 3UTR 100% 13.200 9.240 N LDB1 n/a
6 TRCN0000285406 GCTACTTCCGCAGCATCTTTG pLKO_005 333 3UTR 100% 10.800 7.560 N LDB1 n/a
7 TRCN0000021787 GCAACCAAACTGACTACAGAA pLKO.1 147 3UTR 100% 4.950 3.465 N LDB1 n/a
8 TRCN0000275509 GCCATGTTGACCATCACTTTC pLKO_005 260 3UTR 100% 10.800 6.480 N LDB1 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1440 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1437 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.