Transcript: Human XR_001747858.1

PREDICTED: Homo sapiens beta-1,4-N-acetyl-galactosaminyltransferase 4 (B4GALNT4), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B4GALNT4 (338707)
Length:
3505
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747858.1
NBCI Gene record:
B4GALNT4 (338707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428638 TCCGACTGCGGAATTTCTATC pLKO_005 3089 3UTR 100% 10.800 15.120 N B4GALNT4 n/a
2 TRCN0000035034 CCGGAGGTACTACTTTGAGTT pLKO.1 748 3UTR 100% 4.950 6.930 N B4GALNT4 n/a
3 TRCN0000431477 GGAGAGGTTTGGGTTCTATAA pLKO_005 1222 3UTR 100% 13.200 9.240 N B4GALNT4 n/a
4 TRCN0000418601 AGGTGAACCTGCACGTGTTTG pLKO_005 390 3UTR 100% 10.800 7.560 N B4GALNT4 n/a
5 TRCN0000035037 TGGGATCTACAAGTCGGACTT pLKO.1 2961 3UTR 100% 4.050 2.835 N B4GALNT4 n/a
6 TRCN0000035036 GCAATTTGTGTACCTGTCCTT pLKO.1 1120 3UTR 100% 2.640 1.848 N B4GALNT4 n/a
7 TRCN0000035038 CCTGAGACGAACCGGGAACTT pLKO.1 2712 3UTR 100% 1.650 1.155 N B4GALNT4 n/a
8 TRCN0000035035 GCCTGGAGAATTCACCAAGTT pLKO.1 688 3UTR 100% 0.000 0.000 N B4GALNT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.