Transcript: Human XR_001747907.2

PREDICTED: Homo sapiens phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha (PIK3C2A), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3C2A (5286)
Length:
5544
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747907.2
NBCI Gene record:
PIK3C2A (5286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002230 CGAGCAGTAGATCAAGTAATT pLKO.1 1879 3UTR 100% 13.200 18.480 N PIK3C2A n/a
2 TRCN0000002228 CCACTTATGCTTTACCTTCTA pLKO.1 614 3UTR 100% 4.950 6.930 N PIK3C2A n/a
3 TRCN0000194763 CTTACCGAAATGGTACTCTTT pLKO.1 4711 3UTR 100% 4.950 6.930 N PIK3C2A n/a
4 TRCN0000194822 CCTATCCAGATATCACAATTG pLKO.1 2407 3UTR 100% 10.800 8.640 N PIK3C2A n/a
5 TRCN0000196458 GTATTACCAGTTACTCCTATT pLKO.1 511 3UTR 100% 10.800 8.640 N PIK3C2A n/a
6 TRCN0000002231 CAAAGAAGTATGGAACGAGTA pLKO.1 3391 3UTR 100% 4.050 3.240 N PIK3C2A n/a
7 TRCN0000195283 CCTGTTCAAGTAAGCATAAAC pLKO.1 2083 3UTR 100% 13.200 9.240 N PIK3C2A n/a
8 TRCN0000196363 GAATCCGACATTCAATGAAAT pLKO.1 4865 3UTR 100% 13.200 9.240 N PIK3C2A n/a
9 TRCN0000196308 GATGACAGTTTCGAGACTAAA pLKO.1 481 3UTR 100% 13.200 9.240 N PIK3C2A n/a
10 TRCN0000199468 GCCTGCATTGTACCCACTAAT pLKO.1 2967 3UTR 100% 13.200 9.240 N PIK3C2A n/a
11 TRCN0000024889 CGGCAAGATATGTTAGCTTTA pLKO.1 3595 3UTR 100% 10.800 7.560 N Pik3c2a n/a
12 TRCN0000199065 CCACCCTTTACTTCGTGATGA pLKO.1 4601 3UTR 100% 4.950 3.465 N PIK3C2A n/a
13 TRCN0000002232 CGAATCAAGGAAGTCTCTGTT pLKO.1 4275 3UTR 100% 4.950 3.465 N PIK3C2A n/a
14 TRCN0000002229 GCTAGTGTGAAGGTCTCCATT pLKO.1 1429 3UTR 100% 4.950 3.465 N PIK3C2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.