Transcript: Human XR_001748692.1

PREDICTED: Homo sapiens chromosome 12 open reading frame 42 (C12orf42), transcript variant X23, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C12orf42 (374470)
Length:
779
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748692.1
NBCI Gene record:
C12orf42 (374470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282813 TTTCTCTGAATCTCCTAAATT pLKO_005 357 3UTR 100% 15.000 10.500 N C12orf42 n/a
2 TRCN0000167353 CCAGATTCATTAATCACATGA pLKO.1 332 3UTR 100% 4.950 3.465 N C12orf42 n/a
3 TRCN0000166867 CCTTGTTATGAAAGAACTTCA pLKO.1 301 3UTR 100% 4.950 3.465 N C12orf42 n/a
4 TRCN0000282816 TACCCTGCTCCAGATTCATTA pLKO_005 323 3UTR 100% 0.000 0.000 N C12orf42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14483 pDONR223 100% 36% None (many diffs) n/a
2 ccsbBroad304_14483 pLX_304 0% 36% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV