Transcript: Human XR_001748730.2

PREDICTED: Homo sapiens tyrosyl-tRNA synthetase 2 (YARS2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YARS2 (51067)
Length:
2390
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748730.2
NBCI Gene record:
YARS2 (51067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215482 GAATGGACTTTCCTTACTTAA pLKO.1 1952 3UTR 100% 13.200 18.480 N Yars2 n/a
2 TRCN0000146614 CCTTCTGGTTGTCCAAATAAA pLKO.1 2027 3UTR 100% 15.000 10.500 N YARS2 n/a
3 TRCN0000148708 CTGGAACAAGTGTCCTAGATA pLKO.1 1798 3UTR 100% 5.625 3.938 N YARS2 n/a
4 TRCN0000149028 GTCCGGATATGAGTTCATCAA pLKO.1 1340 3UTR 100% 4.950 3.465 N YARS2 n/a
5 TRCN0000149593 CCAGAACTTAGACCTTTGCTT pLKO.1 2089 3UTR 100% 3.000 2.100 N YARS2 n/a
6 TRCN0000147880 GTACCCTAAATCTCTCAGTAT pLKO.1 631 3UTR 100% 0.000 0.000 N YARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03188 pDONR223 100% 59.8% None 1_584del;2016_2390del n/a
2 ccsbBroad304_03188 pLX_304 0% 59.8% V5 1_584del;2016_2390del n/a
Download CSV