Transcript: Human XR_001748913.1

PREDICTED: Homo sapiens phospholipase C zeta 1 (PLCZ1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCZ1 (89869)
Length:
2138
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748913.1
NBCI Gene record:
PLCZ1 (89869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434147 ACTTTAACCCAAGTAACATAA pLKO_005 1791 3UTR 100% 13.200 18.480 N PLCZ1 n/a
2 TRCN0000097173 CCTTATCTGATCTTGTCATTT pLKO.1 1425 3UTR 100% 13.200 18.480 N Plcz1 n/a
3 TRCN0000001548 GTCAAGGTTTAATAGCAGGAA pLKO.1 1925 3UTR 100% 2.640 3.696 N PLCZ1 n/a
4 TRCN0000001547 CGTGAATGTCTACTGTTTAAA pLKO.1 680 3UTR 100% 15.000 12.000 N PLCZ1 n/a
5 TRCN0000428046 GATATTCGGTGCAGTTATATT pLKO_005 353 3UTR 100% 15.000 12.000 N PLCZ1 n/a
6 TRCN0000424657 AGATATGACTCATCCATTAAA pLKO_005 724 3UTR 100% 15.000 10.500 N PLCZ1 n/a
7 TRCN0000001545 CCTGCTTCACTGTTTGTTTAT pLKO.1 2041 3UTR 100% 13.200 9.240 N PLCZ1 n/a
8 TRCN0000001546 CCATAGAAGAATTTAGAGCAA pLKO.1 426 3UTR 100% 2.640 1.848 N PLCZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12925 pDONR223 100% 49.1% None (many diffs) n/a
2 ccsbBroad304_12925 pLX_304 0% 49.1% V5 (many diffs) n/a
Download CSV