Transcript: Human XR_001749709.1

PREDICTED: Homo sapiens protein Z, vitamin K dependent plasma glycoprotein (PROZ), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROZ (8858)
Length:
1311
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749709.1
NBCI Gene record:
PROZ (8858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056029 GTGGTGTTATAATACGGGAAA pLKO.1 1265 3UTR 100% 4.050 2.835 N PROZ n/a
2 TRCN0000056030 GCGGGCTCCTATCTTCTGGAA pLKO.1 308 3UTR 100% 0.880 0.616 N PROZ n/a
3 TRCN0000056032 TGATGAATTCTGGAGACGATA pLKO.1 421 3UTR 100% 0.000 0.000 N PROZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02034 pDONR223 100% 57.9% None (many diffs) n/a
2 ccsbBroad304_02034 pLX_304 0% 57.9% V5 (many diffs) n/a
Download CSV