Transcript: Human XR_001750195.1

PREDICTED: Homo sapiens TOG array regulator of axonemal microtubules 1 (TOGARAM1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOGARAM1 (23116)
Length:
6162
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750195.1
NBCI Gene record:
TOGARAM1 (23116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346876 AGACTTTCGTGATCGTATTAA pLKO_005 4632 3UTR 100% 15.000 21.000 N Togaram1 n/a
2 TRCN0000429768 AGACTTTCGTGATCGTATTAA pLKO_005 4632 3UTR 100% 15.000 21.000 N TOGARAM1 n/a
3 TRCN0000428459 GGAGCTGCATTCACGATTATT pLKO_005 1262 3UTR 100% 15.000 21.000 N TOGARAM1 n/a
4 TRCN0000422175 ATCTTCCCGACGAGGTCTAAA pLKO_005 2906 3UTR 100% 13.200 18.480 N TOGARAM1 n/a
5 TRCN0000150257 GCTGATATTGTTACGGAACTT pLKO.1 5023 3UTR 100% 4.950 6.930 N TOGARAM1 n/a
6 TRCN0000148362 CCTCAACTAGTTGTCTCGTTA pLKO.1 747 3UTR 100% 0.000 0.000 N TOGARAM1 n/a
7 TRCN0000417597 GACCACTTATCTCCTATAATC pLKO_005 4816 3UTR 100% 13.200 10.560 N TOGARAM1 n/a
8 TRCN0000146735 CGCTAATATGATTGTGCAGTA pLKO.1 5770 3UTR 100% 4.050 3.240 N TOGARAM1 n/a
9 TRCN0000417607 ACGAACAGCCACAGCTAAATT pLKO_005 5151 3UTR 100% 15.000 10.500 N TOGARAM1 n/a
10 TRCN0000427886 GAACCACCATCAGGGATTTAT pLKO_005 3397 3UTR 100% 15.000 10.500 N TOGARAM1 n/a
11 TRCN0000424727 TATCAACCTTACCACTTATAT pLKO_005 5447 3UTR 100% 15.000 10.500 N TOGARAM1 n/a
12 TRCN0000420672 AGTTCTTGGGACCAGTTATAG pLKO_005 1495 3UTR 100% 13.200 9.240 N TOGARAM1 n/a
13 TRCN0000147246 GTCTCATTTCTCAGCCTTATT pLKO.1 5665 3UTR 100% 13.200 9.240 N TOGARAM1 n/a
14 TRCN0000412886 TACAATTTGTTGCCCTATATG pLKO_005 5587 3UTR 100% 13.200 9.240 N TOGARAM1 n/a
15 TRCN0000421005 TGTTATCAGAAACTAAGTTTG pLKO_005 5711 3UTR 100% 10.800 7.560 N TOGARAM1 n/a
16 TRCN0000149027 GCATGGATCAAGAGCTAGATA pLKO.1 3965 3UTR 100% 5.625 3.938 N TOGARAM1 n/a
17 TRCN0000147224 GCTGAGTACCTTAAACTCATA pLKO.1 4591 3UTR 100% 0.495 0.347 N TOGARAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.