Transcript: Human XR_001751049.2

PREDICTED: Homo sapiens high mobility group 20A (HMG20A), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMG20A (10363)
Length:
2211
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751049.2
NBCI Gene record:
HMG20A (10363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015578 CGCAAATCCAACATGGAGTTT pLKO.1 1022 3UTR 100% 4.950 6.930 N HMG20A n/a
2 TRCN0000276467 CGCAAATCCAACATGGAGTTT pLKO_005 1022 3UTR 100% 4.950 6.930 N HMG20A n/a
3 TRCN0000015579 CCTTACAGGATATGTTCGGTT pLKO.1 622 3UTR 100% 2.640 3.696 N HMG20A n/a
4 TRCN0000276411 GAAGATGAGCAACGAAGTAAA pLKO_005 533 3UTR 100% 13.200 9.240 N HMG20A n/a
5 TRCN0000015581 GTGGACACCATTGACTCATAT pLKO.1 1232 3UTR 100% 13.200 9.240 N HMG20A n/a
6 TRCN0000285558 GTGGACACCATTGACTCATAT pLKO_005 1232 3UTR 100% 13.200 9.240 N HMG20A n/a
7 TRCN0000015580 GCCACATCATCCACCAACAAT pLKO.1 428 3UTR 100% 5.625 3.938 N HMG20A n/a
8 TRCN0000276413 GCCACATCATCCACCAACAAT pLKO_005 428 3UTR 100% 5.625 3.938 N HMG20A n/a
9 TRCN0000015582 TCCCTATATTTACAGAGGAAT pLKO.1 957 3UTR 100% 4.950 3.465 N HMG20A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02409 pDONR223 100% 47% None 1_304del;1346_2211del n/a
2 ccsbBroad304_02409 pLX_304 0% 47% V5 1_304del;1346_2211del n/a
Download CSV