Transcript: Human XR_001751176.1

PREDICTED: Homo sapiens Dmx like 2 (DMXL2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DMXL2 (23312)
Length:
10173
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751176.1
NBCI Gene record:
DMXL2 (23312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145127 GCAAGATCATTCGACCTTTAA pLKO.1 4173 3UTR 100% 13.200 18.480 N DMXL2 n/a
2 TRCN0000144796 GCCTTGCATGAGATATGTAAT pLKO.1 6535 3UTR 100% 13.200 18.480 N DMXL2 n/a
3 TRCN0000338675 GCCTTGCATGAGATATGTAAT pLKO_005 6535 3UTR 100% 13.200 18.480 N DMXL2 n/a
4 TRCN0000141435 CGCTGCTAACTGAATGGAATA pLKO.1 1778 3UTR 100% 10.800 15.120 N DMXL2 n/a
5 TRCN0000338674 CGCTGCTAACTGAATGGAATA pLKO_005 1778 3UTR 100% 10.800 15.120 N DMXL2 n/a
6 TRCN0000145518 GCCCGTTTATATGAATCTGAA pLKO.1 5551 3UTR 100% 4.950 3.960 N DMXL2 n/a
7 TRCN0000253306 CATGCTAAGCAGTCCATATTT pLKO_005 8816 3UTR 100% 15.000 10.500 N Dmxl2 n/a
8 TRCN0000253310 GTGTGCCTTGCACCTTATTTA pLKO_005 3310 3UTR 100% 15.000 10.500 N Dmxl2 n/a
9 TRCN0000139224 CCTGGACAGAAGAACGTAGAT pLKO.1 3097 3UTR 100% 4.950 3.465 N DMXL2 n/a
10 TRCN0000140323 CCAGTTACTGTCTAGGCACAT pLKO.1 2588 3UTR 100% 4.050 2.835 N DMXL2 n/a
11 TRCN0000141277 CTACAGTCATCACTAGGCAAT pLKO.1 9022 3UTR 100% 4.050 2.835 N DMXL2 n/a
12 TRCN0000253309 CATGGTTATTGCCCGTTTATT pLKO_005 5541 3UTR 100% 15.000 10.500 N Dmxl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.