Transcript: Human XR_001751356.1

PREDICTED: Homo sapiens family with sequence similarity 214 member A (FAM214A), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM214A (56204)
Length:
4120
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751356.1
NBCI Gene record:
FAM214A (56204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168233 CGGTTATTACGCTACCTCATA pLKO.1 3105 3UTR 100% 4.950 6.930 N FAM214A n/a
2 TRCN0000167133 CTAAAGTGTTTAGGAGTTCAT pLKO.1 1718 3UTR 100% 4.950 3.960 N FAM214A n/a
3 TRCN0000183469 GTACTGTTGAAACCACTTCAT pLKO.1 3486 3UTR 100% 4.950 3.465 N Fam214a n/a
4 TRCN0000172637 GCACAGTCTTGTTACCCAGTA pLKO.1 310 3UTR 100% 4.050 2.835 N FAM214A n/a
5 TRCN0000167982 CGAACACCTGAATGTTCTGTA pLKO.1 256 3UTR 100% 0.495 0.347 N FAM214A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.