Transcript: Human XR_001751411.2

PREDICTED: Homo sapiens diphthamine biosynthesis 6 (DPH6), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPH6 (89978)
Length:
792
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751411.2
NBCI Gene record:
DPH6 (89978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242719 CCCTCTATCGCCGAACCATAA pLKO_005 255 3UTR 100% 10.800 15.120 N DPH6 n/a
2 TRCN0000242721 GGAAGGACAGCTGCTATAATA pLKO_005 81 3UTR 100% 15.000 10.500 N DPH6 n/a
3 TRCN0000257161 AGATCGTTGCTTTAGCAAATC pLKO_005 129 3UTR 100% 10.800 7.560 N DPH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04502 pDONR223 100% 79.5% None 1_52del;619_620ins95;759_792del n/a
2 ccsbBroad304_04502 pLX_304 0% 79.5% V5 1_52del;619_620ins95;759_792del n/a
3 TRCN0000467870 GACCCTCCCGTTTGTGAAGTCACG pLX_317 42.6% 79.5% V5 1_52del;619_620ins95;759_792del n/a
Download CSV