Transcript: Human XR_001752500.2

PREDICTED: Homo sapiens glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GDPD1 (284161)
Length:
1639
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752500.2
NBCI Gene record:
GDPD1 (284161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143449 GCTAGAATTGGACTGCCATAT pLKO.1 350 3UTR 100% 10.800 15.120 N GDPD1 n/a
2 TRCN0000144449 CGAGGCATTCAAGTGTATATT pLKO.1 742 3UTR 100% 15.000 10.500 N GDPD1 n/a
3 TRCN0000144619 GAAATCCCAATGCCTTCTATT pLKO.1 613 3UTR 100% 13.200 9.240 N GDPD1 n/a
4 TRCN0000121818 GCAGTGTTCTATCATAAGTAA pLKO.1 1276 3UTR 100% 5.625 3.938 N GDPD1 n/a
5 TRCN0000145458 GATGATGCAGTGTTCTATCAT pLKO.1 1270 3UTR 100% 0.563 0.394 N GDPD1 n/a
6 TRCN0000139251 CCAGAGAAAGAAGCAGCGATT pLKO.1 233 3UTR 100% 4.050 2.430 N GDPD1 n/a
7 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 1392 3UTR 100% 4.050 2.025 Y GDPD1 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1354 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05376 pDONR223 100% 35.1% None (many diffs) n/a
2 ccsbBroad304_05376 pLX_304 0% 35.1% V5 (many diffs) n/a
Download CSV