Transcript: Human XR_001753178.1

PREDICTED: Homo sapiens structural maintenance of chromosomes flexible hinge domain containing 1 (SMCHD1), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMCHD1 (23347)
Length:
8521
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753178.1
NBCI Gene record:
SMCHD1 (23347)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253778 ATTGGATAGCGGGTGATATTA pLKO_005 3365 3UTR 100% 15.000 21.000 N SMCHD1 n/a
2 TRCN0000253777 TTATTCGAGTGCAACTAATTT pLKO_005 3920 3UTR 100% 15.000 21.000 N SMCHD1 n/a
3 TRCN0000253775 TGGCGAGTTCTATGGATATTA pLKO_005 7953 3UTR 100% 15.000 12.000 N SMCHD1 n/a
4 TRCN0000253776 CACGACAGTTAGCGCATATTT pLKO_005 1217 3UTR 100% 15.000 10.500 N SMCHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11724 pDONR223 100% 8.4% None 1_5323del;5583_5584ins71;6054_8521del n/a
2 ccsbBroad304_11724 pLX_304 0% 8.4% V5 1_5323del;5583_5584ins71;6054_8521del n/a
3 TRCN0000469964 CCTGCTGATGTGTGGTGATTCTCT pLX_317 54.2% 8.4% V5 1_5323del;5583_5584ins71;6054_8521del n/a
Download CSV