Construct: ORF TRCN0000469964
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015872.1_s317c1
- Derived from:
- ccsbBroadEn_11724
- DNA Barcode:
- CCTGCTGATGTGTGGTGATTCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMCHD1 (23347)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469964
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23347 | SMCHD1 | structural maintenance of c... | XM_017025684.1 | 14.2% | 13.8% | 1_4650del;5428_5530del;5555_5637del |
| 2 | human | 23347 | SMCHD1 | structural maintenance of c... | NM_015295.2 | 13.3% | 13.3% | 1_5214del |
| 3 | human | 23347 | SMCHD1 | structural maintenance of c... | XM_011525643.2 | 13% | 12.9% | 1_5214del;5993_5994insGATTATAACCAAAAC;5999_6012delinsTA |
| 4 | human | 23347 | SMCHD1 | structural maintenance of c... | XM_011525642.1 | 12.9% | 12.5% | 1_5214del;5992_6094del;6119_6201del |
| 5 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753176.1 | 11.2% | (many diffs) | |
| 6 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753174.1 | 10.7% | 1_5403del;5663_5664ins71;6134_6727del | |
| 7 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753177.1 | 9.3% | 1_5315del;6117_8584del | |
| 8 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753173.1 | 8.8% | 1_5403del;6182_6183insGATTATAACCAAAAC;6188_8886delinsTA | |
| 9 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753172.1 | 8.8% | 1_5403del;6182_6183insGATTATAACCAAAAC;6188_8890delinsTA | |
| 10 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753178.1 | 8.4% | 1_5323del;5583_5584ins71;6054_8521del | |
| 11 | human | 23347 | SMCHD1 | structural maintenance of c... | XR_001753175.1 | 8% | (many diffs) | |
| 12 | mouse | 74355 | Smchd1 | SMC hinge domain containing 1 | XM_030250119.1 | 13.1% | 12.9% | (many diffs) |
| 13 | mouse | 74355 | Smchd1 | SMC hinge domain containing 1 | NM_028887.4 | 11.4% | 11.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 867
- ORF length:
- 801
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tatttcttgg catctggcaa gtgacatgga ctgtgtagtc accctaacca 121 ctgacgctgc acgtcgtatc tatgatgaaa cccaaggtcg tcagcaggtg ttgccccttg 181 attctattta caagaagact cttccagatt ggaaaagatc tctacctcat ttccgaaatg 241 gaaaattgta ttttaaaccc attggagatc cagtctttgc tcgagacttg ttaacatttc 301 cagataatgt agaacattgt gaaacagtat ttggtatgct gttaggagac accattattt 361 tggataatct ggatgcggcc aatcattata gaaaagaggt tgttaaaatt acacactgtc 421 ctacactgct gaCCAGAGAT GGAGATCGAA TTCGAAGTAA TGGAAAGTTT GGGGGCCTTC 481 AGAATAAAGC TCCTCCAATG GATAAACTTC GGGGAATGGT ATTTGGAGCT CCAGTTCCAA 541 AACAGTGTCT GATCTTAGGG GAACAAATAG ATCTTCTTCA GCAGTATCGT TCTGCTGTGT 601 GCAAACTAGA CAGTGTGAAT AAGGATCTTA ACAGTCAATT AGAGTACCTT CGCACTCCGG 661 ATATGAGGAA GAAAAAGCAA GAACTTGATG AACATGAGAA AAATCTCAAA CTAATAGAGG 721 AAAAACTAGG TATGACTCCC ATACGTAAGT GTAATGACTC ATTGCGTCAT TCACCAAAGG 781 TTGAGACGAC AGATTGTCCA GTTCCTCCTA AAAGAATGAG ACGAGAAGCT ACAAGACAAA 841 ATAGGATTAT AACCAAAACA GATGTATGCC CAACCTTCTT GTACAAAGTG GTTGATATCG 901 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 961 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCTGCTGA 1021 TGTGTGGTGA TTCTCTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1081 aagatt