Transcript: Human XR_001753792.2

PREDICTED: Homo sapiens cytohesin 2 (CYTH2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYTH2 (9266)
Length:
4315
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753792.2
NBCI Gene record:
CYTH2 (9266)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233533 CTGTACGACAGCATCCGAAAT pLKO_005 867 3UTR 100% 10.800 15.120 N CYTH2 n/a
2 TRCN0000062099 GCGGATTTCAGTCAAGAAGAA pLKO.1 4101 3UTR 100% 4.950 3.960 N CYTH2 n/a
3 TRCN0000233535 CAGCGAGAAAGAAGCGGATTT pLKO_005 4088 3UTR 100% 10.800 7.560 N CYTH2 n/a
4 TRCN0000233534 CCGAACTGCTTTGAACTTTAC pLKO_005 3892 3UTR 100% 10.800 7.560 N CYTH2 n/a
5 TRCN0000062101 CAGTTCTTGGTGGAGAATGAA pLKO.1 408 3UTR 100% 5.625 3.938 N CYTH2 n/a
6 TRCN0000062100 CGGAAACCGAACTGCTTTGAA pLKO.1 3886 3UTR 100% 5.625 3.938 N CYTH2 n/a
7 TRCN0000062098 TCCATTATTTATTACGGAGCT pLKO.1 4153 3UTR 100% 2.160 1.296 N CYTH2 n/a
8 TRCN0000233536 TCCATTATTTATTACGGAGCT pLKO_005 4153 3UTR 100% 2.160 1.296 N CYTH2 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2678 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2678 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2678 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2640 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.