Transcript: Human XR_001754293.1

PREDICTED: Homo sapiens phospholipase C gamma 1 (PLCG1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCG1 (5335)
Length:
5112
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754293.1
NBCI Gene record:
PLCG1 (5335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226429 CCGGATGGGATGCCAGTTATT pLKO_005 1235 3UTR 100% 13.200 18.480 N PLCG1 n/a
2 TRCN0000226428 GGAATCGTGAGGATCGTATAT pLKO_005 618 3UTR 100% 13.200 18.480 N PLCG1 n/a
3 TRCN0000380300 TGAGTTTGAGATGCGACTTTC pLKO_005 2062 3UTR 100% 10.800 15.120 N PLCG1 n/a
4 TRCN0000006978 GCCATTGACATTCGTGAAATT pLKO.1 335 3UTR 100% 13.200 9.240 N PLCG1 n/a
5 TRCN0000226427 GCCATTGACATTCGTGAAATT pLKO_005 335 3UTR 100% 13.200 9.240 N PLCG1 n/a
6 TRCN0000382227 TGCTGATCAAGATTGACATTT pLKO_005 3638 3UTR 100% 13.200 9.240 N PLCG1 n/a
7 TRCN0000218478 AGAAGTTCCTTCAGTACAATC pLKO_005 3017 3UTR 100% 10.800 7.560 N PLCG1 n/a
8 TRCN0000006977 CCAGGGAAACAAAGTTTACAT pLKO.1 4305 3UTR 100% 5.625 3.938 N PLCG1 n/a
9 TRCN0000011060 CCAGTCACATTGCTTTGTCAT pLKO.1 427 3UTR 100% 4.950 3.465 N PLCG1 n/a
10 TRCN0000006980 CCTGTGAACCACGAATGGTAT pLKO.1 1619 3UTR 100% 4.950 3.465 N PLCG1 n/a
11 TRCN0000006979 CCAGATCAGTAACCCTGAATT pLKO.1 3465 3UTR 100% 0.000 0.000 N PLCG1 n/a
12 TRCN0000226430 CTGTACTGTGTTTCGCATTAA pLKO_005 4116 3UTR 100% 13.200 7.920 N PLCG1 n/a
13 TRCN0000024976 CCAACTTTCAAGTGTGCAGTA pLKO.1 2489 3UTR 100% 4.050 2.835 N Plcg1 n/a
14 TRCN0000298134 CCAACTTTCAAGTGTGCAGTA pLKO_005 2489 3UTR 100% 4.050 2.835 N Plcg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.