Transcript: Mouse XR_001778039.1

PREDICTED: Mus musculus predicted gene 6909 (Gm6909), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm6909 (628737)
Length:
1478
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778039.1
NBCI Gene record:
Gm6909 (628737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079022 CATCGTACAGCCATGATAATA pLKO.1 811 3UTR 100% 15.000 10.500 N LOC385186 n/a
2 TRCN0000079019 CGCCTGTACAAGTACTTCTAT pLKO.1 703 3UTR 100% 5.625 3.375 N LOC385186 n/a
3 TRCN0000079018 CCATGATAATACAGGAGTTGT pLKO.1 821 3UTR 100% 4.950 2.970 N LOC385186 n/a
4 TRCN0000079021 GCATTTCACGATCAATGACTT pLKO.1 498 3UTR 100% 4.950 2.970 N LOC385186 n/a
5 TRCN0000361476 CTTGATCTCCAAGCTTCTTAG pLKO_005 1215 3UTR 100% 10.800 5.400 Y Aurkc n/a
6 TRCN0000200357 GCTGGCCTTAAACTCAGAGAT pLKO.1 2 3UTR 100% 4.950 2.475 Y Rft1 n/a
7 TRCN0000079020 GTCCTCTTCAAGTCTGAGATA pLKO.1 607 3UTR 100% 4.950 2.475 Y LOC385186 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.