Transcript: Mouse XR_001779003.1

PREDICTED: Mus musculus RIKEN cDNA 9530077C05 gene (9530077C05Rik), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
9530077C05Rik (68283)
Length:
3496
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779003.1
NBCI Gene record:
9530077C05Rik (68283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189561 CGGTTCTTCAAGTCGGACTAT pLKO.1 2369 3UTR 100% 4.950 6.930 N 9530077C05Rik n/a
2 TRCN0000200546 CATGTAGACCTGAAACTATTT pLKO.1 3169 3UTR 100% 13.200 9.240 N 9530077C05Rik n/a
3 TRCN0000192038 CCATGTAGACCTGAAACTATT pLKO.1 3168 3UTR 100% 13.200 9.240 N 9530077C05Rik n/a
4 TRCN0000201761 GCCTGAACATGAACTTGCTAA pLKO.1 1798 3UTR 100% 4.950 3.465 N 9530077C05Rik n/a
5 TRCN0000202104 CCAGTCTAATGCTCTGCAGTA pLKO.1 3335 3UTR 100% 4.050 2.835 N 9530077C05Rik n/a
6 TRCN0000127952 CCTCAGTTTGAGTATGCCAAT pLKO.1 2399 3UTR 100% 4.050 2.835 N KIAA0895 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.