Transcript: Mouse XR_001779052.1

PREDICTED: Mus musculus prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum) (P4htm), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
P4htm (74443)
Length:
2147
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779052.1
NBCI Gene record:
P4htm (74443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246614 AGATGTACTCTGCAATCAAAG pLKO_005 1000 3UTR 100% 10.800 15.120 N P4htm n/a
2 TRCN0000180825 GATCGCTAACAACTGGATCAA pLKO.1 1768 3UTR 100% 4.950 6.930 N P4htm n/a
3 TRCN0000246617 ACAGTCGAGGAGGCCTCAAAT pLKO_005 354 3UTR 100% 13.200 9.240 N P4htm n/a
4 TRCN0000246615 TCGCTAACAACTGGATCAATG pLKO_005 1770 3UTR 100% 10.800 7.560 N P4htm n/a
5 TRCN0000184137 CATACCAAGCTGGTAGCCAAT pLKO.1 1436 3UTR 100% 4.050 2.835 N P4htm n/a
6 TRCN0000246616 TGAAGTTCTGGCCGACCTCTT pLKO_005 1994 3UTR 100% 4.050 2.835 N P4htm n/a
7 TRCN0000246613 CAACAGGACCTATGATGAAAT pLKO_005 1555 3UTR 100% 13.200 7.920 N P4htm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.