Transcript: Mouse XR_001779861.1

PREDICTED: Mus musculus tubulin-specific chaperone d (Tbcd), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbcd (108903)
Length:
5265
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779861.1
NBCI Gene record:
Tbcd (108903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091146 CCGCGTAATTATGGACAAATA pLKO.1 1641 3UTR 100% 13.200 18.480 N Tbcd n/a
2 TRCN0000303172 CCGCGTAATTATGGACAAATA pLKO_005 1641 3UTR 100% 13.200 18.480 N Tbcd n/a
3 TRCN0000091145 GCTGCTGTATTTGACCGAAAT pLKO.1 2956 3UTR 100% 10.800 7.560 N Tbcd n/a
4 TRCN0000303245 GCTGCTGTATTTGACCGAAAT pLKO_005 2956 3UTR 100% 10.800 7.560 N Tbcd n/a
5 TRCN0000091143 GCTTTACCATCATGGAAACTT pLKO.1 5094 3UTR 100% 5.625 3.938 N Tbcd n/a
6 TRCN0000303171 GCTTTACCATCATGGAAACTT pLKO_005 5094 3UTR 100% 5.625 3.938 N Tbcd n/a
7 TRCN0000091147 CCAGCAAGCAAGTGAGAAGAT pLKO.1 4307 3UTR 100% 4.950 3.465 N Tbcd n/a
8 TRCN0000091144 GCCTCATGGATTTGATGCTTT pLKO.1 4219 3UTR 100% 4.950 3.465 N Tbcd n/a
9 TRCN0000315477 GCCTCATGGATTTGATGCTTT pLKO_005 4219 3UTR 100% 4.950 3.465 N Tbcd n/a
10 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 432 3UTR 100% 15.000 7.500 Y KAAG1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 428 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.