Transcript: Mouse XR_001780001.1

PREDICTED: Mus musculus sterile alpha and HEAT/Armadillo motif containing 1 (Sarm1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sarm1 (237868)
Length:
4304
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780001.1
NBCI Gene record:
Sarm1 (237868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193663 CTTTATCAGTTACCGGAGGAA pLKO.1 2209 3UTR 100% 2.640 3.696 N Sarm1 n/a
2 TRCN0000217787 CAAGGTCTATGCGATGCTATA pLKO.1 703 3UTR 100% 10.800 8.640 N Sarm1 n/a
3 TRCN0000432467 AGAACATTGTGCCCATCATTG pLKO_005 2469 3UTR 100% 10.800 7.560 N SARM1 n/a
4 TRCN0000175300 CTGGTTTCTTACTCTACGAAT pLKO.1 1492 3UTR 100% 4.950 3.465 N Sarm1 n/a
5 TRCN0000193408 CTTCTAAGACTCACAGATGAA pLKO.1 1690 3UTR 100% 4.950 3.465 N Sarm1 n/a
6 TRCN0000176361 CCACATTATCAGAGAGCCAAA pLKO.1 4090 3UTR 100% 4.050 2.835 N Sarm1 n/a
7 TRCN0000139869 GCAAGAACATTGTGCCCATCA pLKO.1 2466 3UTR 100% 4.050 2.835 N SARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.