Transcript: Mouse XR_001780029.1

PREDICTED: Mus musculus cytokine receptor-like factor 3 (Crlf3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crlf3 (54394)
Length:
9064
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780029.1
NBCI Gene record:
Crlf3 (54394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780029.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370377 AGTCTGAGCAGTCGAAGAAAT pLKO_005 1101 3UTR 100% 13.200 9.240 N CRLF3 n/a
2 TRCN0000126168 GCAAATGTACTGCAAATCATT pLKO.1 895 3UTR 100% 5.625 3.938 N Crlf3 n/a
3 TRCN0000308425 GCAAATGTACTGCAAATCATT pLKO_005 895 3UTR 100% 5.625 3.938 N Crlf3 n/a
4 TRCN0000126165 CCACTAGATGACTGCCAGAAA pLKO.1 519 3UTR 100% 4.950 3.465 N Crlf3 n/a
5 TRCN0000308427 CCACTAGATGACTGCCAGAAA pLKO_005 519 3UTR 100% 4.950 3.465 N Crlf3 n/a
6 TRCN0000126167 GCTCAGTTGGACGATTCCATT pLKO.1 717 3UTR 100% 4.950 3.465 N Crlf3 n/a
7 TRCN0000315494 GCTCAGTTGGACGATTCCATT pLKO_005 717 3UTR 100% 4.950 3.465 N Crlf3 n/a
8 TRCN0000126164 GCTGTTTCTGTCCTCAGTTTA pLKO.1 8115 3UTR 100% 13.200 7.920 N Crlf3 n/a
9 TRCN0000308358 GCTGTTTCTGTCCTCAGTTTA pLKO_005 8115 3UTR 100% 13.200 7.920 N Crlf3 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 6952 3UTR 100% 4.950 2.475 Y Gad2 n/a
11 TRCN0000063380 CCATTGAACAGGAGACCATTA pLKO.1 496 3UTR 100% 10.800 7.560 N CRLF3 n/a
12 TRCN0000300986 CCATTGAACAGGAGACCATTA pLKO_005 496 3UTR 100% 10.800 7.560 N CRLF3 n/a
13 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6893 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780029.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.