Transcript: Mouse XR_001780438.1

PREDICTED: Mus musculus ATP-binding cassette, sub-family D (ALD), member 4 (Abcd4), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcd4 (19300)
Length:
2150
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780438.1
NBCI Gene record:
Abcd4 (19300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105262 CCCAGATTAGATCTGCAACTT pLKO.1 203 3UTR 100% 4.950 6.930 N Abcd4 n/a
2 TRCN0000105263 CCAGTCAGTATTATGGAGTCT pLKO.1 354 3UTR 100% 2.640 3.696 N Abcd4 n/a
3 TRCN0000308304 CCAGTCAGTATTATGGAGTCT pLKO_005 354 3UTR 100% 2.640 3.696 N Abcd4 n/a
4 TRCN0000304956 TGACCAGCAAGCTGATCATTT pLKO_005 642 3UTR 100% 13.200 9.240 N Abcd4 n/a
5 TRCN0000105261 CCTGTGAGCATCTTTGGATAT pLKO.1 722 3UTR 100% 10.800 7.560 N Abcd4 n/a
6 TRCN0000105264 TGACTAGAATCAAACTGGAAT pLKO.1 2033 3UTR 100% 4.950 3.465 N Abcd4 n/a
7 TRCN0000308310 TGACTAGAATCAAACTGGAAT pLKO_005 2033 3UTR 100% 4.950 3.465 N Abcd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.