Transcript: Mouse XR_001780762.1

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D (Sema4d), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema4d (20354)
Length:
5830
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780762.1
NBCI Gene record:
Sema4d (20354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313019 TACTCTGGGACGTCCTATAAT pLKO_005 1383 3UTR 100% 15.000 21.000 N Sema4d n/a
2 TRCN0000067497 GCAGACGGAATGCCTAAACTA pLKO.1 1175 3UTR 100% 5.625 7.875 N Sema4d n/a
3 TRCN0000067494 CCGTTTGATGTCAAGTGTGAA pLKO.1 3393 3UTR 100% 4.950 6.930 N Sema4d n/a
4 TRCN0000313018 TTCACAAGCCAGGCATCTTTA pLKO_005 988 3UTR 100% 13.200 10.560 N Sema4d n/a
5 TRCN0000067495 CCACAGCTACACATCAGTCAT pLKO.1 1346 3UTR 100% 4.950 3.960 N Sema4d n/a
6 TRCN0000313017 TTTGGGAAGCAAGTATCTATT pLKO_005 3600 3UTR 100% 13.200 9.240 N Sema4d n/a
7 TRCN0000349806 ACTCAGAGAAGACGGTGTATC pLKO_005 3022 3UTR 100% 10.800 7.560 N Sema4d n/a
8 TRCN0000067496 GCGGAACTCAAATGTTTCCAA pLKO.1 2577 3UTR 100% 3.000 2.100 N Sema4d n/a
9 TRCN0000312020 GCGGAACTCAAATGTTTCCAA pLKO_005 2577 3UTR 100% 3.000 2.100 N Sema4d n/a
10 TRCN0000067493 GCAGCCACTCAGAGATAATTT pLKO.1 3741 3UTR 100% 15.000 9.000 N Sema4d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.