Transcript: Mouse XR_001781097.1

PREDICTED: Mus musculus stabilin 1 (Stab1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stab1 (192187)
Length:
7597
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781097.1
NBCI Gene record:
Stab1 (192187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193923 CGTTTATATCCACGACCCAAA pLKO.1 2235 3UTR 100% 4.050 5.670 N Stab1 n/a
2 TRCN0000194394 CGGACCTTTCACTGTCTTTGT pLKO.1 4995 3UTR 100% 4.950 3.960 N Stab1 n/a
3 TRCN0000193353 CGGTTAAATGGTCAACAAGTA pLKO.1 3364 3UTR 100% 4.950 3.960 N Stab1 n/a
4 TRCN0000173536 GCACGGAAACACCATCTCTTT pLKO.1 5619 3UTR 100% 4.950 3.960 N Stab1 n/a
5 TRCN0000215721 CAGTTGCTATGGAGATATTAT pLKO.1 3117 3UTR 100% 15.000 10.500 N Stab1 n/a
6 TRCN0000193613 GCAGCATTTATCTCAATGATT pLKO.1 5198 3UTR 100% 5.625 3.938 N Stab1 n/a
7 TRCN0000176133 GCCACCTTTCTGAGTATCAAT pLKO.1 7357 3UTR 100% 5.625 3.938 N Stab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.