Transcript: Mouse XR_001781352.1

PREDICTED: Mus musculus predicted gene 3252 (Gm3252), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm3252 (100041283)
Length:
1461
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781352.1
NBCI Gene record:
Gm3252 (100041283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270541 ATGAACTAGAAGAACTGAAAT pLKO_005 1034 3UTR 100% 13.200 6.600 Y Gm5796 n/a
2 TRCN0000284416 ACGTAAGGATATTACTGAATG pLKO_005 1316 3UTR 100% 10.800 5.400 Y Gm5796 n/a
3 TRCN0000270542 ACTGATAGAAGATAACTATTC pLKO_005 1242 3UTR 100% 10.800 5.400 Y Gm5796 n/a
4 TRCN0000198693 CAGCAATGACATGGAGGAAAT pLKO.1 1071 3UTR 100% 10.800 5.400 Y Gm5797 n/a
5 TRCN0000197550 CCAAGGAACTGATAGAAGATA pLKO.1 1235 3UTR 100% 5.625 2.813 Y Gm10128 n/a
6 TRCN0000177036 GAAGACAATGTTGGATATGAA pLKO.1 1176 3UTR 100% 5.625 2.813 Y Gm10128 n/a
7 TRCN0000192499 GCAATGACATGGAGGAAATGT pLKO.1 1073 3UTR 100% 5.625 2.813 Y Gm5796 n/a
8 TRCN0000192160 CACAACATGAGAAGACAATGT pLKO.1 1166 3UTR 100% 4.950 2.475 Y Gm3696 n/a
9 TRCN0000192274 CAGTACTCCAAGGAACTGATA pLKO.1 1228 3UTR 100% 4.950 2.475 Y Gm10128 n/a
10 TRCN0000178217 GAAGAGGGAATCCTTTCTCAT pLKO.1 916 3UTR 100% 4.950 2.475 Y Gm10413 n/a
11 TRCN0000177971 GAGGAAGATCAGCAATGACAT pLKO.1 1062 3UTR 100% 4.950 2.475 Y Gm10128 n/a
12 TRCN0000177037 GATAACTATTCCTACAGCATT pLKO.1 1252 3UTR 100% 4.950 2.475 Y Gm10128 n/a
13 TRCN0000182285 GCAGTACTCCAAGGAACTGAT pLKO.1 1227 3UTR 100% 4.950 2.475 Y D830030K20Rik n/a
14 TRCN0000202002 CAGACCAACAGAGAAGGAAGA pLKO.1 900 3UTR 100% 4.050 2.025 Y Gm3696 n/a
15 TRCN0000202051 CATGCAGTACTCCAAGGAACT pLKO.1 1224 3UTR 100% 4.050 2.025 Y Gm10128 n/a
16 TRCN0000177121 GAAGGAAATCATTCTGGAGAA pLKO.1 947 3UTR 100% 4.050 2.025 Y Gm10128 n/a
17 TRCN0000198181 CCAGTCCATAATTGGTTCCAT pLKO.1 1206 3UTR 100% 3.000 1.500 Y Gm10128 n/a
18 TRCN0000191015 CTAGAAGAACTGAAATTGGAT pLKO.1 1039 3UTR 100% 3.000 1.500 Y Gm5796 n/a
19 TRCN0000189430 CAACAGAGAAGGAAGAGGGAA pLKO.1 905 3UTR 100% 2.640 1.320 Y Gm10128 n/a
20 TRCN0000191748 GAAGAAGGAAATCATTCTGGA pLKO.1 944 3UTR 100% 2.640 1.320 Y Gm5796 n/a
21 TRCN0000190046 GACATGGAGGAAATGTGTGGA pLKO.1 1078 3UTR 100% 2.640 1.320 Y Gm3696 n/a
22 TRCN0000201827 GTCCATAATTGGTTCCATGCA pLKO.1 1209 3UTR 100% 2.640 1.320 Y Gm3696 n/a
23 TRCN0000200182 CTACAGCATTAAGGAGGACCA pLKO.1 1263 3UTR 100% 2.160 1.080 Y D830030K20Rik n/a
24 TRCN0000196168 GAATGAGAACAGAAGGCTGCT pLKO.1 1332 3UTR 100% 2.160 1.080 Y 2610042L04Rik n/a
25 TRCN0000189809 GATCAGCAATGACATGGAGGA pLKO.1 1068 3UTR 100% 2.160 1.080 Y Gm10128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.