Transcript: Mouse XR_001781499.1

PREDICTED: Mus musculus oxidation resistance 1 (Oxr1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Oxr1 (170719)
Length:
4438
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781499.1
NBCI Gene record:
Oxr1 (170719)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198261 GCCTGGATTCATAGTAGTCAA pLKO.1 1828 3UTR 100% 4.950 6.930 N Oxr1 n/a
2 TRCN0000346008 GCCTGGATTCATAGTAGTCAA pLKO_005 1828 3UTR 100% 4.950 6.930 N Oxr1 n/a
3 TRCN0000197650 CCCAATGAACTTGTTCAGTTA pLKO.1 332 3UTR 100% 4.950 3.465 N Oxr1 n/a
4 TRCN0000298131 CCCAATGAACTTGTTCAGTTA pLKO_005 332 3UTR 100% 4.950 3.465 N Oxr1 n/a
5 TRCN0000176903 GCCTACTTACATTTAGTTCTA pLKO.1 3130 3UTR 100% 4.950 3.465 N Oxr1 n/a
6 TRCN0000293127 GCCTACTTACATTTAGTTCTA pLKO_005 3130 3UTR 100% 4.950 3.465 N Oxr1 n/a
7 TRCN0000181476 CCTATGTCTCAGAGTCGGAAA pLKO.1 1627 3UTR 100% 4.050 2.835 N Oxr1 n/a
8 TRCN0000293072 CCTATGTCTCAGAGTCGGAAA pLKO_005 1627 3UTR 100% 4.050 2.835 N Oxr1 n/a
9 TRCN0000159728 GCATCGATTACATAAGTTCTT pLKO.1 1609 3UTR 100% 4.950 3.465 N OXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.