Transcript: Mouse XR_001781541.1

PREDICTED: Mus musculus sperm associated antigen 1 (Spag1), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spag1 (26942)
Length:
4787
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781541.1
NBCI Gene record:
Spag1 (26942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353302 CAATCGAGCTCAGGCCGAAAT pLKO_005 2068 3UTR 100% 10.800 15.120 N Spag1 n/a
2 TRCN0000353301 GACGATGCTGACACTAATTAA pLKO_005 3932 3UTR 100% 15.000 12.000 N Spag1 n/a
3 TRCN0000353369 GATGCAGTTGCATGGGTAAAG pLKO_005 4100 3UTR 100% 10.800 8.640 N Spag1 n/a
4 TRCN0000336087 GACGTCTCCAAGCCTACTAAT pLKO_005 3678 3UTR 100% 13.200 9.240 N Spag1 n/a
5 TRCN0000336086 GCTAGATCCCGGAAACGTAAA pLKO_005 2140 3UTR 100% 10.800 7.560 N Spag1 n/a
6 TRCN0000114260 CCTGCCACTGTTGCTAAGTAA pLKO.1 3791 3UTR 100% 5.625 3.938 N Spag1 n/a
7 TRCN0000114257 GCCACTACATATAAACATCAA pLKO.1 2177 3UTR 100% 4.950 3.465 N Spag1 n/a
8 TRCN0000114258 GCCTACTAATGCCTATGAGTT pLKO.1 3689 3UTR 100% 4.950 3.465 N Spag1 n/a
9 TRCN0000114259 GCACGAATCTTAACAGAGCTA pLKO.1 2966 3UTR 100% 2.640 1.848 N Spag1 n/a
10 TRCN0000155149 GCCTATAACAATCGAGCTCAA pLKO.1 2060 3UTR 100% 4.050 5.670 N SPAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781541.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.