Transcript: Mouse XR_001781782.1

PREDICTED: Mus musculus armadillo repeat gene deleted in velo-cardio-facial syndrome (Arvcf), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arvcf (11877)
Length:
3560
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781782.1
NBCI Gene record:
Arvcf (11877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109621 GCTTTGAGAACGAGGGTATTA pLKO.1 1181 3UTR 100% 13.200 18.480 N Arvcf n/a
2 TRCN0000219442 TGTCCTACCACGTGCACAAAG pLKO.1 1757 3UTR 100% 10.800 15.120 N Arvcf n/a
3 TRCN0000109622 CTGGTAGACAAGAGCCTTGAT pLKO.1 2580 3UTR 100% 4.950 6.930 N Arvcf n/a
4 TRCN0000109623 GTCCCGTGATATTCCAAGCTA pLKO.1 606 3UTR 100% 3.000 4.200 N Arvcf n/a
5 TRCN0000219440 CACTAGACCAGCGGAACAAAG pLKO.1 2213 3UTR 100% 10.800 8.640 N Arvcf n/a
6 TRCN0000219441 AGGAAAGACACAGATAATAAG pLKO.1 1702 3UTR 100% 13.200 9.240 N Arvcf n/a
7 TRCN0000109620 GCCTGCTGTTTGTGACTTTAA pLKO.1 3490 3UTR 100% 13.200 9.240 N Arvcf n/a
8 TRCN0000219439 ATATGGCCTGGAGGATGATAC pLKO.1 798 3UTR 100% 10.800 7.560 N Arvcf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.