Transcript: Mouse XR_001782026.1

PREDICTED: Mus musculus potassium channel, subfamily T, member 1 (Kcnt1), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnt1 (227632)
Length:
6135
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782026.1
NBCI Gene record:
Kcnt1 (227632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421548 GCAACGAGGTGTACCACATTC pLKO_005 1826 3UTR 100% 10.800 15.120 N Kcnt1 n/a
2 TRCN0000126865 GCACGAAGTATAACTACACTT pLKO.1 593 3UTR 100% 4.950 6.930 N Kcnt1 n/a
3 TRCN0000053646 GCAAATTTAACAGCCAGTGAT pLKO.1 3719 3UTR 100% 4.950 3.960 N KCNT1 n/a
4 TRCN0000126866 GCATAGCATCATCGCCTCTAT pLKO.1 2139 3UTR 100% 4.950 3.960 N Kcnt1 n/a
5 TRCN0000126864 GCTGACTTCATTCTTGTTTAT pLKO.1 4875 3UTR 100% 13.200 9.240 N Kcnt1 n/a
6 TRCN0000419946 GACTGGAACCCAACGACATTG pLKO_005 3840 3UTR 100% 10.800 7.560 N Kcnt1 n/a
7 TRCN0000126867 GCTGGTCAAGAACCGAATGAA pLKO.1 3661 3UTR 100% 5.625 3.938 N Kcnt1 n/a
8 TRCN0000053644 CCTCAGCTACAAAGGCAACAT pLKO.1 738 3UTR 100% 4.950 3.465 N KCNT1 n/a
9 TRCN0000126868 CCACTGCAATTTGAAGAGCTT pLKO.1 1177 3UTR 100% 2.640 1.848 N Kcnt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.