Transcript: Mouse XR_001782027.1

PREDICTED: Mus musculus catsper channel auxiliary subunit delta (Catsperd), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsperd (106757)
Length:
2247
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782027.1
NBCI Gene record:
Catsperd (106757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197387 CTCTAAGTACAAACTGGATAT pLKO.1 1623 3UTR 100% 10.800 15.120 N Catsperd n/a
2 TRCN0000178232 GACATAGCTGACAAGACACTT pLKO.1 1732 3UTR 100% 4.950 6.930 N Catsperd n/a
3 TRCN0000177955 GAGTATGTCATCTCGGAGATA pLKO.1 2018 3UTR 100% 4.950 6.930 N Catsperd n/a
4 TRCN0000217046 CCAGGATGACCTGATAGTATT pLKO.1 1888 3UTR 100% 13.200 9.240 N Catsperd n/a
5 TRCN0000200057 CCTCTGGAACAGAGAGAACTA pLKO.1 2149 3UTR 100% 4.950 3.465 N Catsperd n/a
6 TRCN0000216779 GGTTTAAGGCAAACCTCAATG pLKO.1 1577 3UTR 100% 1.080 0.756 N Catsperd n/a
7 TRCN0000198043 CGCTTCAACCATGTAATGTCA pLKO.1 1418 3UTR 100% 3.000 2.100 N Catsperd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.