Transcript: Mouse XR_001782040.1

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class Q (Pigq), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pigq (14755)
Length:
3038
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782040.1
NBCI Gene record:
Pigq (14755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243327 TCCGCCTCCTGATGCAGATAA pLKO_005 1689 3UTR 100% 13.200 18.480 N PIGQ n/a
2 TRCN0000243326 AGGTCATGCTCATCTTCTATG pLKO_005 613 3UTR 100% 10.800 7.560 N PIGQ n/a
3 TRCN0000018429 CGCTCTGTACTACCTGGTATT pLKO.1 1501 3UTR 100% 10.800 7.560 N Pigq n/a
4 TRCN0000345692 CGCTCTGTACTACCTGGTATT pLKO_005 1501 3UTR 100% 10.800 7.560 N Pigq n/a
5 TRCN0000178916 CAGGTCATGCTCATCTTCTAT pLKO.1 612 3UTR 100% 5.625 3.938 N PIGQ n/a
6 TRCN0000018426 CCTGTCCTATAACCATGTGAT pLKO.1 1714 3UTR 100% 4.950 3.465 N Pigq n/a
7 TRCN0000345693 CCTGTCCTATAACCATGTGAT pLKO_005 1714 3UTR 100% 4.950 3.465 N Pigq n/a
8 TRCN0000018427 CGAGTGGATTCTTGTTCCTAT pLKO.1 1415 3UTR 100% 4.950 3.465 N Pigq n/a
9 TRCN0000018428 CTCTTCCGAAATGACCAATTT pLKO.1 762 3UTR 100% 13.200 7.920 N Pigq n/a
10 TRCN0000345765 CTCTTCCGAAATGACCAATTT pLKO_005 762 3UTR 100% 13.200 7.920 N Pigq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.