Transcript: Mouse XR_001782072.1

PREDICTED: Mus musculus scaffold attachment factor B2 (Safb2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Safb2 (224902)
Length:
3259
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782072.1
NBCI Gene record:
Safb2 (224902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377193 GGACATTCCCAGGGCTATATT pLKO_005 2980 3UTR 100% 15.000 10.500 N Safb2 n/a
2 TRCN0000367098 CAAGGAACAGCAGCGCATTAT pLKO_005 2349 3UTR 100% 13.200 9.240 N Safb2 n/a
3 TRCN0000376267 CTTCCGTGTCAGACCTTAAAG pLKO_005 790 3UTR 100% 13.200 9.240 N Safb2 n/a
4 TRCN0000376268 TCACCGAGATCGTGGCCATTA pLKO_005 2559 3UTR 100% 10.800 7.560 N Safb2 n/a
5 TRCN0000123597 AGCCAGTCATTAAAGATGAAA pLKO.1 1531 3UTR 100% 5.625 3.938 N Safb2 n/a
6 TRCN0000123594 ACTGAACTGCTCTGGACCAAA pLKO.1 3098 3UTR 100% 4.950 3.465 N Safb2 n/a
7 TRCN0000123596 GAGGACAGATACCGAGACTTT pLKO.1 2506 3UTR 100% 4.950 3.465 N Safb2 n/a
8 TRCN0000123595 GCATTTAAGGAGGAAGGACAA pLKO.1 399 3UTR 100% 4.050 2.835 N Safb2 n/a
9 TRCN0000123598 CCTGGAGGAAGATTCCAGATA pLKO.1 524 3UTR 100% 0.495 0.347 N Safb2 n/a
10 TRCN0000376329 GTTAAGGAAGAACAAGATATA pLKO_005 1509 3UTR 100% 13.200 7.920 N Safb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.