Transcript: Mouse XR_001782093.1

PREDICTED: Mus musculus A kinase (PRKA) anchor protein 8 (Akap8), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akap8 (56399)
Length:
4287
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782093.1
NBCI Gene record:
Akap8 (56399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336109 GATATTCCCACCGAATGATTT pLKO_005 2685 3UTR 100% 13.200 18.480 N Akap8 n/a
2 TRCN0000353306 TCCGTGGACCATAACCATAAT pLKO_005 2130 3UTR 100% 13.200 18.480 N Akap8 n/a
3 TRCN0000336166 GCCAACACCCAGGGTACATAT pLKO_005 27 3UTR 100% 13.200 10.560 N Akap8 n/a
4 TRCN0000336107 CAAAGAGACTTTGCGATTTAT pLKO_005 1871 3UTR 100% 15.000 10.500 N Akap8 n/a
5 TRCN0000362424 GTGCACTGCAGTTAGAATAAT pLKO_005 2918 3UTR 100% 15.000 10.500 N Akap8 n/a
6 TRCN0000336108 AGTAGATCTTCCTGGTAATTG pLKO_005 2942 3UTR 100% 13.200 9.240 N Akap8 n/a
7 TRCN0000362506 CCTCCAGGAGTACATCATAAA pLKO_005 1925 3UTR 100% 13.200 9.240 N Akap8 n/a
8 TRCN0000088768 CCTCTATTTGTGCAGGATTAT pLKO.1 3802 3UTR 100% 13.200 9.240 N Akap8 n/a
9 TRCN0000362426 CCTGTATACCTGAGCATAATC pLKO_005 893 3UTR 100% 13.200 9.240 N Akap8 n/a
10 TRCN0000088772 GCCCTGTATACCTGAGCATAA pLKO.1 891 3UTR 100% 10.800 7.560 N Akap8 n/a
11 TRCN0000088771 GCCTGTTCTGTATGCAAGTTT pLKO.1 1800 3UTR 100% 5.625 3.938 N Akap8 n/a
12 TRCN0000088769 CCAAAGATATTCCCACCGAAT pLKO.1 2680 3UTR 100% 4.050 2.835 N Akap8 n/a
13 TRCN0000088770 GCCCGACAAGACAGTAGAATT pLKO.1 1904 3UTR 100% 0.000 0.000 N Akap8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.